ID: 1034275976_1034275990

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1034275976 1034275990
Species Human (GRCh38) Human (GRCh38)
Location 7:149824034-149824056 7:149824079-149824101
Sequence CCTGGACTGGGTCCTGCCTCCCT CCCACAGTGAATGCCGGCGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 2, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!