ID: 1034378387_1034378389

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1034378387 1034378389
Species Human (GRCh38) Human (GRCh38)
Location 7:150666636-150666658 7:150666654-150666676
Sequence CCTCAGCAACATGGGAAGACATT ACATTTGTACAGATGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 74, 4: 1009} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!