ID: 1034418723_1034418734

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1034418723 1034418734
Species Human (GRCh38) Human (GRCh38)
Location 7:150978182-150978204 7:150978215-150978237
Sequence CCCGCTCCGCCGCGTCCCCGCGC CCGCCCGAGCCCCGGACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 552} {0: 1, 1: 0, 2: 3, 3: 26, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!