ID: 1034459613_1034459623

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1034459613 1034459623
Species Human (GRCh38) Human (GRCh38)
Location 7:151191280-151191302 7:151191313-151191335
Sequence CCCTCTTCCCTCCACACCTGCAG TGCATTCCCAAGGCCATCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 79, 4: 658} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!