ID: 1034578833_1034578835

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1034578833 1034578835
Species Human (GRCh38) Human (GRCh38)
Location 7:152025584-152025606 7:152025600-152025622
Sequence CCGGTGACGTCAGGGCAGCGAGA AGCGAGAGGTTTCGTCACCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!