ID: 1034622865_1034622873

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1034622865 1034622873
Species Human (GRCh38) Human (GRCh38)
Location 7:152469790-152469812 7:152469841-152469863
Sequence CCGTGATTCTGAGGCTTCCCCAG CTCTTTCTGTTCCTAGTTTCTGG
Strand - +
Off-target summary {0: 61, 1: 1957, 2: 6404, 3: 6025, 4: 3568} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!