ID: 1034622867_1034622873

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1034622867 1034622873
Species Human (GRCh38) Human (GRCh38)
Location 7:152469807-152469829 7:152469841-152469863
Sequence CCCCAGCCATGTGGAACTGTAAG CTCTTTCTGTTCCTAGTTTCTGG
Strand - +
Off-target summary {0: 1791, 1: 5734, 2: 7090, 3: 7321, 4: 5798} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!