ID: 1034622869_1034622873

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1034622869 1034622873
Species Human (GRCh38) Human (GRCh38)
Location 7:152469809-152469831 7:152469841-152469863
Sequence CCAGCCATGTGGAACTGTAAGTC CTCTTTCTGTTCCTAGTTTCTGG
Strand - +
Off-target summary {0: 1834, 1: 5465, 2: 6859, 3: 7257, 4: 5406} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!