ID: 1034686034_1034686038

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1034686034 1034686038
Species Human (GRCh38) Human (GRCh38)
Location 7:152972313-152972335 7:152972328-152972350
Sequence CCTAGGGGGCACAGCCTGAGAGC CTGAGAGCACAGAGGCAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 80, 4: 707}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!