ID: 1034885275_1034885289

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1034885275 1034885289
Species Human (GRCh38) Human (GRCh38)
Location 7:154794180-154794202 7:154794213-154794235
Sequence CCACCACGGGGGTCTGCACGAAG CTGTGGGGGTGGAGGGGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 46} {0: 1, 1: 0, 2: 19, 3: 227, 4: 1811}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!