ID: 1034885452_1034885456

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1034885452 1034885456
Species Human (GRCh38) Human (GRCh38)
Location 7:154795042-154795064 7:154795073-154795095
Sequence CCTTTTATCTAACCTGGGGCGGA TATTCTGATGAGCTTGCTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 25, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!