ID: 1034889798_1034889811

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1034889798 1034889811
Species Human (GRCh38) Human (GRCh38)
Location 7:154829792-154829814 7:154829838-154829860
Sequence CCTGCTCAAAGCCCTCCCACCCT TGCTCCTCATGTGGAATCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 346} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!