ID: 1034889800_1034889811

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1034889800 1034889811
Species Human (GRCh38) Human (GRCh38)
Location 7:154829804-154829826 7:154829838-154829860
Sequence CCTCCCACCCTTCACCACCACCA TGCTCCTCATGTGGAATCTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 260, 4: 1777} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!