ID: 1035018630_1035018648

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1035018630 1035018648
Species Human (GRCh38) Human (GRCh38)
Location 7:155787630-155787652 7:155787680-155787702
Sequence CCCGTCCCTGGTGGGAGCGAGCA GAGGCTCTCCTGCCCCGCGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!