ID: 1035079214_1035079219 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1035079214 | 1035079219 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:156202348-156202370 | 7:156202373-156202395 |
| Sequence | CCCCAAGGTTCTCCATCATCTCA | GGCTCCAAAACAAAATCCACTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 14, 4: 150} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||