ID: 1035133250_1035133261

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1035133250 1035133261
Species Human (GRCh38) Human (GRCh38)
Location 7:156675296-156675318 7:156675339-156675361
Sequence CCGGCTCCCTCCGTCTTTGGAGA GGGTCCTGTGACCCACTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216} {0: 1, 1: 0, 2: 2, 3: 16, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!