ID: 1035329574_1035329580

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1035329574 1035329580
Species Human (GRCh38) Human (GRCh38)
Location 7:158087581-158087603 7:158087613-158087635
Sequence CCCCTGACGAAGGAGGGAGTCTT CTTCCTCCCCTGATGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 17, 2: 36, 3: 22, 4: 84} {0: 2, 1: 16, 2: 30, 3: 29, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!