ID: 1035339391_1035339399

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1035339391 1035339399
Species Human (GRCh38) Human (GRCh38)
Location 7:158150849-158150871 7:158150890-158150912
Sequence CCTCCTTTCTGTTCTTCCAACCC TCCTACTGGTTTGCAGCAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 712} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!