ID: 1035399081_1035399085

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1035399081 1035399085
Species Human (GRCh38) Human (GRCh38)
Location 7:158553054-158553076 7:158553083-158553105
Sequence CCACAGACTTGGGAGTCTACACT CTGCGTACACACACATGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129} {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!