ID: 1035599612_1035599618

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1035599612 1035599618
Species Human (GRCh38) Human (GRCh38)
Location 8:889877-889899 8:889898-889920
Sequence CCCCAGTGGCGTGAGTTTGCAAG AGTGGGATCTTCTGATCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 111} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!