ID: 1035636103_1035636105

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1035636103 1035636105
Species Human (GRCh38) Human (GRCh38)
Location 8:1145407-1145429 8:1145432-1145454
Sequence CCTGGCTGAGCTGGTGTGTGGTG CTCTGTACATGACTCCACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 120, 4: 881} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!