ID: 1035966123_1035966128

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1035966123 1035966128
Species Human (GRCh38) Human (GRCh38)
Location 8:4193871-4193893 8:4193889-4193911
Sequence CCTCAGCAGAACTGGCCACCTCC CCTCCACGAAGGAAAGCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 620} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!