ID: 1036191952_1036191962

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1036191952 1036191962
Species Human (GRCh38) Human (GRCh38)
Location 8:6678649-6678671 8:6678689-6678711
Sequence CCCTGGGCAGGCACGGTGATTCA CTGTGGGAGGCCAAGGTGGATGG
Strand - +
Off-target summary No data {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!