|
Left Crispr |
Right Crispr |
Crispr ID |
1036191956 |
1036191962 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
8:6678674-6678696
|
8:6678689-6678711
|
Sequence |
CCTATAATCCCAGTGCTGTGGGA |
CTGTGGGAGGCCAAGGTGGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 470, 2: 4862, 3: 50062, 4: 354695} |
{0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|