ID: 1036202949_1036202962

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1036202949 1036202962
Species Human (GRCh38) Human (GRCh38)
Location 8:6784525-6784547 8:6784575-6784597
Sequence CCCCGGAGGCCCCTGAGCCAGCC CAGTCACTGCCCCCTCTCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!