ID: 1036355231_1036355235

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1036355231 1036355235
Species Human (GRCh38) Human (GRCh38)
Location 8:8037657-8037679 8:8037698-8037720
Sequence CCGCACCTGGAGGACTGTGGGTA AGCTCAGATCTGCCGACAGCAGG
Strand - +
Off-target summary No data {0: 27, 1: 52, 2: 35, 3: 43, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!