ID: 1036388728_1036388738

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1036388728 1036388738
Species Human (GRCh38) Human (GRCh38)
Location 8:8306229-8306251 8:8306260-8306282
Sequence CCCTGCCAACTGTAGCTGTCAGG AGTAGGTTCCATAAGTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!