ID: 1036407734_1036407736

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1036407734 1036407736
Species Human (GRCh38) Human (GRCh38)
Location 8:8470030-8470052 8:8470050-8470072
Sequence CCTCCTGTAGTGCTGAGATTACA ACACTGTGAGCCACTGCACATGG
Strand - +
Off-target summary {0: 2, 1: 132, 2: 3002, 3: 36776, 4: 353144} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!