ID: 1036432238_1036432257

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1036432238 1036432257
Species Human (GRCh38) Human (GRCh38)
Location 8:8702080-8702102 8:8702127-8702149
Sequence CCGCCCCTGGGCGCCCGCGCCCG CCCGCGGGCTGGTTTCGATTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 54, 4: 441} {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!