ID: 1036549658_1036549662

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1036549658 1036549662
Species Human (GRCh38) Human (GRCh38)
Location 8:9805194-9805216 8:9805214-9805236
Sequence CCTCGTGGACCTTGCTTCAGATG ATGCCAAAAGCCTGGCCACTGGG
Strand - +
Off-target summary No data {0: 19, 1: 12, 2: 6, 3: 34, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!