ID: 1036549663_1036549667

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1036549663 1036549667
Species Human (GRCh38) Human (GRCh38)
Location 8:9805217-9805239 8:9805236-9805258
Sequence CCAAAAGCCTGGCCACTGGGCCT GCCTCAGGATGCCACAGCCCAGG
Strand - +
Off-target summary {0: 19, 1: 12, 2: 4, 3: 37, 4: 580} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!