ID: 1036750794_1036750795

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1036750794 1036750795
Species Human (GRCh38) Human (GRCh38)
Location 8:11442774-11442796 8:11442787-11442809
Sequence CCGACAGCACATGCACCCTCTCG CACCCTCTCGTTACTAAAGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!