ID: 1036755078_1036755085

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1036755078 1036755085
Species Human (GRCh38) Human (GRCh38)
Location 8:11466427-11466449 8:11466440-11466462
Sequence CCCGCGGGAGCGCATGAGCGGCC ATGAGCGGCCTCTCCCGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!