ID: 1036876989_1036876991

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1036876989 1036876991
Species Human (GRCh38) Human (GRCh38)
Location 8:12481797-12481819 8:12481815-12481837
Sequence CCTTTTTCTGGCGCGTCCGTGTG GTGTGAAGAGACCACAAAACAGG
Strand - +
Off-target summary No data {0: 15, 1: 1220, 2: 1135, 3: 381, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!