ID: 1036924945_1036924947

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1036924945 1036924947
Species Human (GRCh38) Human (GRCh38)
Location 8:12895414-12895436 8:12895443-12895465
Sequence CCAGTAACAAGCAGGGTGCCGGT CGCCTGTAATCTGAGCACTTTGG
Strand - +
Off-target summary No data {0: 103, 1: 6683, 2: 150060, 3: 296460, 4: 215179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!