ID: 1036924945_1036924949

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1036924945 1036924949
Species Human (GRCh38) Human (GRCh38)
Location 8:12895414-12895436 8:12895447-12895469
Sequence CCAGTAACAAGCAGGGTGCCGGT TGTAATCTGAGCACTTTGGTAGG
Strand - +
Off-target summary No data {0: 4, 1: 496, 2: 22293, 3: 349007, 4: 259029}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!