ID: 1037050197_1037050204

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1037050197 1037050204
Species Human (GRCh38) Human (GRCh38)
Location 8:14362713-14362735 8:14362766-14362788
Sequence CCAGTCCCAGTGAGGTGAACCAG TCTTCTGTGTCTATCTCATTAGG
Strand - +
Off-target summary {0: 7, 1: 308, 2: 666, 3: 710, 4: 785} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!