ID: 1037050198_1037050204

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1037050198 1037050204
Species Human (GRCh38) Human (GRCh38)
Location 8:14362718-14362740 8:14362766-14362788
Sequence CCCAGTGAGGTGAACCAGTGCCT TCTTCTGTGTCTATCTCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 27, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!