ID: 1037050200_1037050205

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1037050200 1037050205
Species Human (GRCh38) Human (GRCh38)
Location 8:14362732-14362754 8:14362779-14362801
Sequence CCAGTGCCTGAGATGAAAATGCA TCTCATTAGGAGCTGTAGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 31, 3: 2311, 4: 1856} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!