ID: 1037050201_1037050204

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1037050201 1037050204
Species Human (GRCh38) Human (GRCh38)
Location 8:14362738-14362760 8:14362766-14362788
Sequence CCTGAGATGAAAATGCAGAAATC TCTTCTGTGTCTATCTCATTAGG
Strand - +
Off-target summary {0: 1, 1: 29, 2: 2839, 3: 4197, 4: 1996} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!