ID: 1037050203_1037050205

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1037050203 1037050205
Species Human (GRCh38) Human (GRCh38)
Location 8:14362763-14362785 8:14362779-14362801
Sequence CCATCTTCTGTGTCTATCTCATT TCTCATTAGGAGCTGTAGACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 133, 4: 906} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!