ID: 1037179805_1037179807

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1037179805 1037179807
Species Human (GRCh38) Human (GRCh38)
Location 8:15992206-15992228 8:15992221-15992243
Sequence CCTGGCAGCACACATAGATGGAC AGATGGACACCAGTGGTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!