ID: 1037210757_1037210763

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1037210757 1037210763
Species Human (GRCh38) Human (GRCh38)
Location 8:16384312-16384334 8:16384336-16384358
Sequence CCACAGCTCACGCCTGCAATCCC GCACTTTGGCAGGCCAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 191, 3: 3004, 4: 6197} {0: 14, 1: 3693, 2: 70736, 3: 189346, 4: 233205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!