ID: 1037210757_1037210764

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1037210757 1037210764
Species Human (GRCh38) Human (GRCh38)
Location 8:16384312-16384334 8:16384339-16384361
Sequence CCACAGCTCACGCCTGCAATCCC CTTTGGCAGGCCAAGACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 191, 3: 3004, 4: 6197} {0: 6, 1: 1611, 2: 31245, 3: 84062, 4: 158256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!