ID: 1037258256_1037258262

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1037258256 1037258262
Species Human (GRCh38) Human (GRCh38)
Location 8:16979492-16979514 8:16979524-16979546
Sequence CCTTTCTTTCAGAGATGCCCTGC AAGAATATAGAGAAGCAGTCTGG
Strand - +
Off-target summary {0: 521, 1: 668, 2: 432, 3: 346, 4: 1285} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!