|
Left Crispr |
Right Crispr |
Crispr ID |
1037360461 |
1037360467 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
8:18068672-18068694
|
8:18068702-18068724
|
Sequence |
CCTGCAATGCACATGACAGCCCC |
AGAGACACCCACCCCAGGCCGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 37, 2: 249, 3: 688, 4: 1430} |
{0: 2, 1: 0, 2: 4, 3: 38, 4: 411} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|