ID: 1037500430_1037500433

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1037500430 1037500433
Species Human (GRCh38) Human (GRCh38)
Location 8:19480339-19480361 8:19480386-19480408
Sequence CCACTTATTGGTGAGAACACGCA TAGTTTGCTTAGAGCTGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 203, 3: 4161, 4: 11051} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!