ID: 1037693991_1037694002

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1037693991 1037694002
Species Human (GRCh38) Human (GRCh38)
Location 8:21207899-21207921 8:21207917-21207939
Sequence CCCTCTACCCCCCACCCCCACAG CACAGCCAGCTTCCCCTCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 51, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!