ID: 1037814113_1037814118

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1037814113 1037814118
Species Human (GRCh38) Human (GRCh38)
Location 8:22102912-22102934 8:22102925-22102947
Sequence CCCCGGAAGGGCAGGTCTGAGCC GGTCTGAGCCAGCACCAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 163} {0: 1, 1: 0, 2: 5, 3: 24, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!