ID: 1037828910_1037828925

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1037828910 1037828925
Species Human (GRCh38) Human (GRCh38)
Location 8:22176938-22176960 8:22176971-22176993
Sequence CCTGAGCTGGCCCCGCCCTCCAG TACGTGGGTCGCCGCGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 410} {0: 1, 1: 0, 2: 1, 3: 1, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!